logo
advertisement
  CRTER   NRR
  BRM   JCS
  SCIR   TCT
  TCMC   TOGT

Adenomyosis uterine innervation in mice correlates to nerve growth factor expression, inflammation, and vascularization*☆

Publisher:gaosbwb  Publish Time:Thursday, February 25, 2010 
Source:nrr

Adenomyosis uterine innervation in mice correlates to nerve growth factor expression, inflammation, and vascularization*☆
Yan Li, Shaofen Zhang, Xian Xia, Shien Zou

Department of Gynaecology, Obstetrics and Gynaecology Hospital of Fudan University, Shanghai  200011, China
Yan Li☆, Studying for doctorate, Department of Gynaecology, Obstetrics and Gynaecology Hospital of Fudan University, Shanghai   200011, China

Corresponding author: Shaofen Zhang, Professor, Chief physician, Doctoral supervisor, Department of Gynaecology, Obstetrics and Gynaecology Hospital of Fudan University, Shanghai  200011, China   
zhangshaofen@163.com

Supported by: the Construction Program of Shanghai Medical Intensive Subject (Obstetrics and Gynaecology), No. 05-111-0165*

Abstract
BACKGROUND: Studies have shown that abnormal innervation is an important factor impacting occurrence and development of pathological pain in endometriosis.
OBJECTIVE: To observe uterine innervation of adenomyosis mice and to analyze the cause of innervation changes due to nerve growth factor (NGF) expression, inflammation, and vasculariza-tion.
DESIGN, TIME AND SETTING: This randomized, controlled, animal experiment was performed at the Research Institute of Obstetrics and Gynecology Hospital, and Central Laboratory of Zhongshan Hospital, Fudan University from March to December 2008.
MATERIALS: Tamoxifen was provided by Fudan Forward, China. Rabbit anti-mouse NGF was purchased from Santa Cruz Corporation, USA; rabbit anti-protein gene product 9.5 (PGP9.5) and rabbit anti-substance P (SP) were purchased from Chemicon, USA.
METHODS: A total of 40 newborn ICR mice were randomly assigned to adenomyosis model and control groups, with 20 animals in each group. Mice in the adenomyosis model group were orally administrated 2.7 μmol/kg tamoxifen on days 2–5 after birth, while the controls were not treated.
MAIN OUTCOME MEASURES: Both uteri from all mice were harvested at days 135–145 after birth. Expressions of polyclonal PGP9.5 and SP were immunohistochemically detected to demonstrate pan- and sensory nerve fibers. Microvessel density was quantified in the endometrium and myo-metrium using immunochemical staining for polyclonal rabbit anti-CD31, which stained vessels. Gene expression for NGF, high-affinity tyrosine kinase receptor (trkA), p75 neurotrophin receptor (p75NTR), bradykinin receptor-1 (BKR-1), and 2 (BKR-2), as well as substance P receptor (neu-rokinin1 receptor, NK1-R), were detected by reverse transcription-polymerase chain reaction. NGF-β protein expression was detected by Western blot analysis.
RESULTS: More nerve fibers were stained with PGP9.5 in the endometrium and myometrium, and with SP in the endometrium, in adenomyosis mice compared with controls (P < 0.01 and P < 0.05). Microvessel density in the myometrium of adenomyosis mice was significantly greater than the controls (P < 0.01). In the uterus of adenomyosis mice, mRNA expression of NGF and its two re-ceptors (trkA and p75 NTR), BKR-1, and NK1-R, as well as protein expression of NGF-β, were greater than the control mice (P < 0.01 or P < 0.05).
CONCLUSION: Uterine innervation in the adenomyosis mice was increased compared with the controls. Moreover, NGF expression, inflammation, and vascularization, which have been shown to be impact factors of innervation, were abnormal in the uteri of adenomyosis mice. 
Key Words: adenomyosis; innervation; nerve growth factor; inflammation; vascularization

INTRODUCTION
  
Adenomyosis is defined as a benign, deep, and haphazard invasion of endometrial glands and stroma into the myometrium. In symptomatic women with adenomyosis, pain is one of the common complaints[1]. However, the mechanisms of adenomy-osis-related pain remain poorly understood.
Abnormal innervation has been determined to be one reason for pathologic pain. Studies have shown that endometriosis, a disease that shares similar symptoms but different pathogenesis with adenomyosis, exhibits altered uterine innervation, which may con-tribute to adenomyosis-induced pain. Stud-ies of peritoneal[2-3], rectovaginal[4], or bowel[5] endometriosis nodes have demon-strated that the number of nerve innerva-tions, or nerve fiber lengths, are altered compared with controls. Small nerve fibers have been detected in the functional layer of endometriosis women, but not in women without endometriosis[6]. These studies suggested that abnormal uterine innervation might play an important part in adenomy-osis-related pain. However, to date, very little data has been available concerning increased uterine innervation in adenomy-osis patients or animal models.
 
The present study hypothesized that adenomy-osis-related pain could correlate to innervation. There-fore, the estrous cycle was controlled and innervation of the entire mice uteri was analyzed. Nerve growth factor (NGF) expression, inflammation, and vascularization have been shown to be important factors of innervation. This study described patterns of innervation in normal and adenomyosis uteri, examined mRNA expression of NGF and its receptors, tyrosine kinase receptor (trkA) and p75 neurotrophin receptor (p75NTR), as well as bradykinin receptor-1 (BKR-1) and 2 (BKR-2), substance P receptor (neurokinin1 receptor, NK1-R), and NGF-β protein expression. Uterine vascularization was also quantified to determine the possible influential factors of uterine innervations and to illuminate the mechanism of innervation changes.      

MATERIALS AND METHODS

Design
A randomized, controlled, animal experiment.
Time and setting
This experiment was performed at the Research Institute of Obstetrics and Gynecology Hospital, and Central Laboratory of Zhongshan Hospital, Fudan University from March to December 2008.
Materials
Main reagents and instrument are listed as follows:


 

A total of 40 healthy, female, newborn, ICR mice, aged 2–5 days, weighing 18–24 g, were provided by Shanghai SLAC Laboratory Animal (No. SCXK 2007- 0005). All mice were randomly assigned to adenomyosis model and control groups (n = 20), and were separately housed in negative pressure with a 12-hour alternating light-dark cycle. The animals were allowed free access to food and water. The entire experimental procedures were performed in accor-dance with the Guide for Use of Laboratory Animals formu-lated by Fudan University.
Methods
Animal treatment
ICR mice were orally administrated 2.7 μmol/kg ta-moxifen suspended in 5 μL/g peanut oil/lecithin/condensed milk mixture (volume ratio: 2: 0.2: 3). The control mice received no treatment. Mice were sac-rificed at 5 p.m. on days 135 to 145 by injecting propofol (10 mg/kg, i.v.). The 4-day estrous cycle was determined by the presence of characteristic vaginal discharge at 9 a.m. on sacrifice day[7]. Each group had equal numbers of mice in different estrous cycles (each estrous cycle included five mice for each group). Both uteri were har-vested and immediately stored in liquid nitrogen or fixed in 4% neutral buffered formalin at 4 °C.
Hematoxylin-eosin (HE) staining and immunohisto-chemistry
The 5-μm thick paraffin sections from the uteri were de-waxed and hydrated by immersing in xylene and gra-dient alcohol. HE staining was performed to determine the presence of adenomyosis nodes. Sections were immersed in boiling citrate buffer (pH 6.0) for 20 minutes. Endogenous peroxidase activity was blocked with 3% H2O2 for 30 minutes, followed by goat serum for 15 min-utes to block non-specific antigen. The sections were incubated with rabbit anti-PGP9.5 antibody     (1: 1 000), rabbit anti-SP antibody (1: 500), and rabbit anti-CD31 antibody (1: 200) at 4 °C overnight. After washing, sections were incubated with biotinylated goat anti-rabbit IgG and streptavidin-peroxidase complex for 15 minutes each. Staining was visualized with DAB and hematoxylin counterstain, and examined using a BX51 microscope equipped with a DP71 digital camera.
Nerve fiber counting
An assessment of nerve fiber density was performed by Image Pro Plus Discovery system. A total of three im-ages were selected from each sample to quantify posi-tive nerve fibers in the endometrium and myometrium, as well as total area covering the sections of endometrium and myometrium. The number of nerve fibers was di-vided by the area covering the endometrium or myo-metrium to obtain nerve fiber density. Immunochemical staining for PGP9.5 and SP was separately used to re-veal pan and sensory nerve fibers.
Microvessel counting
Immunochemical staining for CD31 was used to quantify microvessels. Microvessel density in the endometrium and myometrium of ICR mice was assessed using the above-mentioned methods for nerve fiber counting. The total number of microvessels was divided by the area covering the endometrium or myometrium to obtain mi-crovessel density.
Semi-quantitative RT-PCR
Total RNA was extracted using Trizol Reagent. A total of 20 μL cDNA was synthesized from 1 μg RNA using oligo and Superscript II Reverse Transcriptase. The primers were for β-actin (forward, 5’- CCT CTA TGC CAA CAC AGT GC-3’; and reverse, 5’- GTA CTC CTG CTT GCT GAT CC-3’), for NGF (forward, 5’- GTC CCT GAA GCC CAC TG-3’; reverse, 5’- GTC TGC CCT GTC ACT CG-3’), for trkA (forward, 5’-ACG CAT TGG AGG ACA GAT T-3’; reverse, 5’- TGCTCATGCCAAAGTCTCCA -3’), for p75NTR (forward, 5’- GAG TGC TGC AAA GCC TGC AA-3’; reverse, 5’- TCG TCC TGG TAG TAG CCA TA -3’), for BKR-1 (forward, 5’-GCA GAA ATC TAC CTG GCT AA-3’ ; reverse, 5’-AGC GGT CCT GAC TGA TGG-3), for BKR-2 (forward, 5’-TTT GAC TGG GTG TTT GGA G-3’; reverse, 5’-GTA GCG GTC GAT ACT CAC G-3’) and for NK1-R (forward, 5’-TTG TCA TCT GGG TCC TGG-3’; reverse, 5’-GGT ACG CTT TCT CGT AAG TC-3’).
Western blot analysis
Control or adenomyosis mouse uteri were separately homogenized and dissolved in iced RIPA buffer (10 μL/mg tissue) with 1 mmol/L phenylmethylsulfonyl fluoride. Each sample contained 30 μg protein and was separated by 12% SDS-PAGE. Subsequently, the protein bands were electrically transferred to PVDF membrane at 250 mA for 1 hour. After blocking with 10% defatted milk protein, the membrane was incubated with rabbit anti-mouse NGF antibody at a dilution of 1: 100 or monoclonal anti-mouse β-actin at a 1: 1 000 dilution at 4 °C overnight. Following washing, the membrane was incubated with secondary goat anti-rabbit IgG-HRP antibody at a dilution of 1: 5 000 for 1 hour. The chemiluminescent signal was developed using ECL Western bolt kit and quantified using Fluochem FC2 Imaging system.
Main outcome measures
Pan- and sensory nerve fiber density, as well as mi-crovessel density was quantified. In addition, mRNA ex-pressions of NGF and its receptors, bradykinin receptors, and P substance receptors were determined, and NGF protein expression in the uteri of ICR mice was detected.
Design, enforcement, and evaluation
This experiment was designed and evaluated by Yan Li and Shaofen Zhang, and performed by Yan Li, Xian Xia, and Shien Zou. The blind method was used to quantify nerve and microvessel densities.
Statistical analysis
All data were analyzed by SAS 6.12 (SAS institute, USA) and expressed as Mean ± SD. Results were subjected to one-way ANOVA to compare the mean values. P < 0.05 was considered statistically significant.

RESULTS

Adenomyosis model
Typical sections from adenomyosis and control mice uterus are shown in Figures 1A and B. All mice (n = 20) that received tamoxifen developed adenomyosis, with a success rate of 100%. However, no adenomyosis nodes were observed in the uterus of control animals (Figure 1B).


PGP9.5 and SP immunohistochemistry
Typical immunohistochemistry sections for PGP9.5 and SP are shown in Figures 1C–F. There were significantly more PGP9.5-positive nerve fibers positive in the en-dometrium and myometrium in adenomyosis mice com-pared with controls (P < 0.01, P < 0.05, Figures 1C, D and Table 1). Moreover, there were significantly more SP-positive nerve fibers in the endometrium of adeno-myosis mice compared with controls (P < 0.01, Figures 1E, F and Table 1).


Vascular characteristics in uterus of ICR mice
Typical sections from CD31 immunohistochemistry stainings are shown in Figures 1G, H. The microvessel density in myometrium of adenomyosis mice was sig-nificantly greater than the controls (P < 0.01, Table 2).


Gene expression of NGF, trkA, p75NTR, BKR-1, BKR2, and NK1-R in the uterus of ICR mice
The electrophoretogram of RT-PCR products is shown in Figure 2. Statistical analysis suggested that mRNA ex-pression of NGF, trkA, p75NTR, BKR-1, and NK1-R in the uterus of adenomyosis mice was significantly greater than the controls (P < 0.05 for BK1, P < 0.01 for others). However, there was no significant difference in BK2 mRNA expression between the two groups (P > 0.05).

Western blot analysis of NGF expression in uterus of ICR mice
Western blot analysis of NGF in the uterus of adenomy-osis and control mice is shown in Figure 3. NGF expres-sion in the uterus of adenomyosis mice was significantly increased compared with the control mice  (P < 0.01).

DISCUSSION

The present study analyzed neural plasticity in the uterus and its possible impact on adenomyosis in mice. Results showed endometrium- and myometrium-innervated pro-liferation in adenomyosis mice. Moreover, NGF and its receptors trkA and p75NTR, as well as BKR-1 and NK1-R, mRNA expression increased in the entire uterus of adenomyosis mice compared with controls. Adeno-myosis mice exhibited significantly more CD31-positive vascularization in the myometrium. Therefore, it was hypothesized that neurotrophic factors, inflammation, and vascularization might contribute to altered uterine nerve innervation in adenomyosis mice.


Several methods have been utilized to induce adeno-myosis in mouse models, such as pituitary grafts[8], ex-posure to progesterone[9], and tamoxifen administra-tion[10]. In the present study, tamoxifen was administered, and the success rate of model establishment was con-sistent with previous studies[10-11]. In clinical studies, it is difficult to obtain normal uteri for controls, and innerva-tion of the uterus, due to gynecological diseases or pregnancy, may be altered[12-14]. In addition, adenomy-osis is always complicated by hysteromyoma and en-dometriosis, which may affect innervation[15-16]. Ta-moxifen-induced adenomyosis in mice results in rela-tively normal serum hormone levels[17], and no other diseases have been diagnosed or observed[10, 18]. Com-pared with previous models that transferred the thalamus to the cornua uteri[19-20], this animal model avoided trauma due to surgery, which may result in nerve injury and regeneration changes. Therefore, it is an excellent animal model for innervation research.
Eutopic endometrium invades the myometrium and forms adenomyosis nodes. In most conditions, there are no clear boundaries, and they are difficult to identify. Therefore, the present study simultaneously quantified nerve fibers in eutopic and ectopic endometrium. Results showed a greater number of PGP9.5- and SP-positive nerve fibers in the endometrium of adenomyosis mice compared with controls (P < 0.01). PGP9.5 is a pan-nerve fiber marker, and SP is typically expressed in sense nerve fibers[2]. These results suggested that in-nervation, including sensory nerve innervation, prolifer-ated in the uterus of adenomyosis mice, which was con-sistent with previous studies[2-5]. In addition, innervation may correlate to severity of endometriosis symp-toms[16-17]. Nevertheless, adenomyosis patients have presented with decreased innervation of the isthmus uteri[21]. This result is contradictory to the fact that ade-nomyosis patients have hyperalgesia of uterus, and pain mediators react with nociceptors to induce pain. In ad-dition to disease progression, calculation methods, and uterine sample locations, the difference in ratio of mice/patients in various estrous/menstrual cycles could affect these results. Uterine innervation alters various estrous cycles in physiological and pathological states[16, 22-23]. In the present study, mRNA expression of SP receptor (NK1-R) was elevated in adenomyosis uterus. Through NK1-R, SP plays an important role in pain and immune modulation[24-25]. SP augments no-ciceptive pain transmission while maintaining its own expression by elevating NK1-R expression[24].
NGF, the first discovered neurotrophic factor, plays a critical role in survival regulation of neural crest-derived sympathetic and sensory neurons during prenatal and perinatal development[26-27]. Later in life, NGF regulates differential growth of neurons, as well as the extent of axonal and dendritic arborization[26-27]. Studies have shown that the uterus expresses NGF, which may con-tribute to neural plasticity of the uterus in physiological and pathological conditions[28-30]. The possible cause for increased NGF protein levels due to endometrio-sis-related enhanced uterine innervation has been as-sessed in patients and animal models. Almost all related studies have demonstrated intense NGF immunoreactiv-ity adjacent to ectopic endometriotic glands[6, 16, 29], and the receptors of NGF, either trkA[31-32] or p75NTR[2], are immunoreactive in nerve fibers surrounding endometri-otic glands and blood vessels. In the case of adenomy-osis, NGF-α, not NGF-β, has been shown to be strongly expressed in mice[11]. In the present study, NGF-β gene and protein levels, as well as its receptors, were in-creased in the entire uterus of the adenomyosis mice compared with the controls. Adenomyosis-induced uter-ine nerve innervation may result in increased expression of NGF and its receptors.
Inflammation is another important factor that influences nerve innervation. The effect of inflammation on innerva-tion appears paradoxical. Inflammatory mediators have been demonstrated to be harmful to nervous tissue un-der certain circumstances, and may benefit nerve re-generation or sprouting[33-35]. It is well known that ade-nomyosis is accompanied by various autoimmune phe-nomena. Patients with adenomyosis have an increased number of macrophages in ectopic and eutopic endo-metrium, as well as gamma delta T cells and elevated pre-inflammatory factors and cytokines (TNF-α, IL-1, IL-6, etc.) in the uterus or peritoneal fluid[36-38]. BKR-1 and BKR-2 are bradykinin receptors, which influence in-flammation due to inflammatory responses and pain. BKR-1 has been shown to be induced or upregulated at the site of inflammation or injury[39]. BKR-2 has been recognized as a constructive expression protein, and is not altered in different circumstances[39]. In the present study, BKR-1 served as a marker for inflammation. BKR-1 expression was upregulated in the uteri of ade-nomyosis mice, but BKR-2 expression remained un-changed. This demonstrated that inflammation and the related internal environment changes may also be re-sponsible for nerve uterine innervation.
Angiogenesis is important in the pathomechanisms of adenomyosis[40-41]. It not only contributes to disease oc-currence and development, but also influences innerva-tion. In endometriosis nodes, nerve supplies have been detected adjacent to blood vessel[6, 16]. This suggests that innervation develops via sprouting of perivascular and paravascular fibers accompanying sprouting blood ves-sels. Microvessel density is a typical index used to measure angiogenesis. In the present study, adenomy-osis induction increased myometrium microvessel den-sity. Increased vascularization may be a result of aug-mented muscle mesenchyma and may correlate to in-nervation proliferation.
In conclusion, uterine innervation in a mouse model of adenomyosis was increased compared with controls. NGF expression, inflammation, and vascularization, which influence neural plasticity, were also abnormal in the uteri of adenomyosis mice compared with controls. However, only one stage of adenomyosis was observed in the present study. Further studies are needed to determine whether innervation and related factors are altered during the course of disease, whether conditions in adenomyosis patients are similar, and whether innervation changes indeed influence pain.

REFERENCES

[1] Levgur M, Abadi MA, Tucker A. Adenomyosis: symptoms, histology, and pregnancy terminations. Obstet Gynecol. 2000;95(5):688-691.
[2] Tokushige N, Markham R, Russell P, et al. Nerve fibres in peritoneal endometriosis. Hum Reprod. 2006;21(11):3001-3007.
[3] Berkley KJ, Dmitrieva N, Curtis KS, et al. Innervation of ectopic endometrium in a rat model of endometriosis. Proc Natl Acad Sci U S A. 2004;101(30):11094-11098.
[4] Anaf V, Simon P, El Nakadi I, et al. Relationship between endometriotic foci and nerves in rectovaginal endometriotic nodules. Hum Reprod. 2000;15(8):1744-1750.
[5] Anaf V, El Nakadi I, Simon P, et al. Preferential infiltration of large bowel endometriosis along the nerves of the colon. Hum Reprod. 2004;19(4):996-1002.
[6] Tokushige N, Markham R, Russell P, et al. High density of small nerve fibres in the functional layer of the endometrium in women with endometriosis. Hum Reprod. 2006;21(3):782-787.
[7] Sell SL, Dillon AM, Cunningham KA, et al. Estrous cycle influence on individual differences in the response to novelty and cocaine in female rats. Behav Brain Res. 2005;161(1):69-74.
[8] Mori T, Nagasawa H. Mechanisms of development of prolactin-induced adenomyosis in mice. Acta Anat (Basel). 1983;116(1):46-54.
[9] Ostrander PL, Mills KT, Bern HA. Long-term responses of the mouse uterus to neonatal diethylstilbestrol treatment and to later sex hormone exposure. J Natl Cancer Inst. 1985;74(1):121-135.
[10] Parrott E, Butterworth M, Green A, et al. Adenomyosis--a result of disordered stromal differentiation. Am J Pathol. 2001;159(2): 623-630.
[11] Green AR, Edwards RE, Greaves P, et al. Comparison of the effect of oestradiol, tamoxifen and raloxifene on nerve growth factor-alpha expression in specific neonatal mouse uterine cell types using laser capture microdissection. J Mol Endocrinol. 2003;30(1):1-11.
[12] Quinn M. Pre-eclampsia and partial uterine denervation. Med Hypotheses. 2005;64(3):449-454.
[13] Brauer MM. Cellular and molecular mechanisms underlying plasticity in uterine sympathetic nerves. Auton Neurosci. 2008;140(1-2):1-16.
[14] Ting?ker BK, Ekman-Ordeberg G, Facer P, et al. Influence of pregnancy and labor on the occurrence of nerve fibers expressing the capsaicin receptor TRPV1 in human corpus and cervix uteri. Reprod Biol Endocrinol. 2008;6:8.
[15] Quinn M. Uterine innervation in fibroids: a qualitative study. J Obstet Gynaecol. 2007;27(5):489-492.
[16] Zhang G, Dmitrieva N, Liu Y, et al. Endometriosis as a neurovascular condition: estrous variations in innervation, vascularization, and growth factor content of ectopic endometrial cysts in the rat. Am J Physiol Regul Integr Comp Physiol. 2008; 294(1):R162-171.
[17] Jefferson WN, Padilla-Banks E, Newbold RR. Adverse effects on female development and reproduction in CD-1 mice following neonatal exposure to the phytoestrogen genistein at environmentally relevant doses. Biol Reprod. 2005;73(4):798-806.
[18] Greaves P, White IN. Experimental adenomyosis. Best Pract Res Clin Obstet Gynaecol. 2006;20(4):503-510.
[19] Mori T, Nagasawa H. Mechanisms of development of prolactin- induced adenomyosis in mice. Acta Anat (Basel). 1983;116(1): 46-54.
[20] Matsuda M, Sasabe H, Adachi Y, et al. Increased invasion activity of endometrial stromal cells and elevated expression of matrix metalloproteinase messenger RNA in the uterine tissues of mice with experimentally induced adenomyosis. Am J Obstet Gynecol. 2001;185(6):1374-1380.
[21] Quinn M. Uterine innervation in adenomyosis. J Obstet Gynaecol. 2007;27(3):287-291.
[22] Latini C, Frontini A, Morroni M, et al. Remodeling of uterine innervation. Cell Tissue Res. 2008;334(1):1-6.
[23] Tokushige N, Markham R, Russell P, et al. Effects of hormonal treatment on nerve fibers in endometrium and myometrium in women with endometriosis. Fertil Steril. 2008;90(5):1589-1598.
[24] Velázquez RA, McCarson KE, Cai Y, et al. Upregulation of neurokinin-1 receptor expression in rat spinal cord by an N-terminal metabolite of substance P. Eur J Neurosci. 2002;16(2): 229-241.
[25] Bost KL. Tachykinin-mediated modulation of the immune response. Front Biosci. 2004;9:3331-3332.
[26] Skaper SD. The biology of neurotrophins, signalling pathways, and functional peptide mimetics of neurotrophins and their receptors. CNS Neurol Disord Drug Targets. 2008;7(1):46-62.
[27] Reichardt LF. Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci. 2006;361(1473):1545-1564.
[28] Shi Z, Arai KY, Jin W, et al. Expression of nerve growth factor and its receptors NTRK1 and TNFRSF1B is regulated by estrogen and progesterone in the uteri of golden hamsters. Biol Reprod. 2006;74(5):850-856.
[29] Mechsner S, Schwarz J, Thode J, et al. Growth-associated protein 43-positive sensory nerve fibers accompanied by immature vessels are located in or near peritoneal endometriotic lesions. Fertil Steril. 2007;88(3):581-587.
[30] Richeri A, Bianchimano P, Mármol NM, et al. Plasticity in rat uterine sympathetic nerves: the role of TrkA and p75 nerve growth factor receptors. J Anat. 2005;207(2):125-134.
[31] Anaf V, Simon P, El Nakadi I, et al. Hyperalgesia, nerve infiltration and nerve growth factor expression in deep adenomyotic nodules, peritoneal and ovarian endometriosis. Hum Reprod. 2002;17(7): 1895-1900.
[32] Chalar C, Richeri A, Viettro L, et al. Plasticity in developing rat uterine sensory nerves: the role of NGF and TrkA. Cell Tissue Res. 2003;314(2):191-205.
[33] Wang Q, Tang XN, Yenari MA. The inflammatory response in stroke. J Neuroimmunol. 2007;184(1-2):53-68.
[34] Hendrix S, Peters EM. Neuronal plasticity and neuroregeneration in the skin-the role of inflammation. J Neuroimmunol. 2007; 184(1-2):113-126.
[35] G?lz G, Uhlmann L, Lüdecke D, et al. The cytokine/neurotrophin axis in peripheral axon outgrowth. Eur J Neurosci. 2006;24(10): 2721-2730.
[36] Ota H, Igarashi S, Tanaka T. Expression of gamma delta T cells and adhesion molecules in endometriotic tissue in patients with endometriosis and adenomyosis. Am J Reprod Immunol. 1996; 35(5):477-482.
[37] Yang JH, Wu MY, Chen CD, et al. Altered apoptosis and proliferation in endometrial stromal cells of women with adenomyosis. Hum Reprod. 2007;22(4):945-952.
[38] Ota H, Igarashi S, Hatazawa J, et al. Is adenomyosis an immune disease. Hum Reprod. 1998;4(4):360-367.
[39] Chen JJ, Johnson EJ. Targeting the bradykinin B1 receptor to reduce pain. Expert Opin Ther Targets. 2007;11(1):21-35.
[40] Zhou YF, Mori T, Kudo H, et al. Effects of angiogenesis inhibitor TNP-470 on the development of uterine adenomyosis in mice. Fertil Steril. 2003;80 Suppl 2:788-794.
[41] Li T, Li YG, Pu DM. Matrix metalloproteinase-2 and -9 expression correlated with angiogenesis in human adenomyosis. Gynecol Obstet Invest. 2006;62(4):229-235.
 (Edited by Ruan XY/Su LL/Song LP)
 

 

Title
Size
Type
Modification Dates
Download Rate
15-20.pdf
208.1K
PDF
Thursday, February 25, 2010
0

 

Print』『Close

      
      

All rights reserved    
Publishing House of Journal of Clinical Rehabilitation Tissue Engineering Research 
Publishing House of Neural Regeneration Research
CRTER website group Liao ICP 05011357

CRTER   Address:p.o.box  1200, shenyang  110004   Tel:024-23384352  Fax:024-23388105   Submission:
http://oa.crter.org/zglckfen/ch/index.aspx
NRR       Address:p.o.box  1234, shenyang  110004   Tel:024-23394178  Fax:024-23394178   Submission:
http://oa.crter.org/nrren/ch/index.aspx